from Escherichia coli
The amino acids in the 'body' of the IHF molecule are arranged mainly in alpha-helices (red) whereas the 'arms' are characterized by beta-sheets (yellow). The enzyme is a hetero dimer formed by an alpha- (HimA, Mr 11350) and a beta-subunit (HimD, Mr 10650). The subunits are homologous (25% identical amino acids), the larger one contains 6 additional amino acids. The arms of the molecule are formed by two stranded beta-sheets which are joined in a flexible manner by nonstructured sequences. IHF binds sequence specific to DNA in the vicinity of regulatory sequences (binding sites of sigma54, repressors etc.).
The DNA in the complex is a 35mer containing the H'-binding site of the lambda attP attachment sequence:
AAAAAAGCATTGCTTATCAATTTGTTGCA TTTTTTCGTAACGAATAGTTAAACAACGT
The three conserved parts of the sequence neccessary for the interaction with IHF are marked in italics.
The arms of the protein protrude into the minor groove of the DNA . The conserved stretches of the DNA are recognized by Argα 60 and Argα 63 in the alpha-subunit as well as by Argβ 46 in the beta-subunit. Serα 47 in the alpha-subunit binds to the dA/dT-tract .
The bends in the DNA are provoked by intercalation of conserved proline residues of the arms (Proα 65 and Proβ 64) between AT-base pairs . Thus the base stacking is abolished and the minor groove widened. The axis of the DNA is bent thereby about 80º at each proline . The bent structure of the DNA is stabilized by interaction of the peptide chain in the body of IHF with phosphate residues of the DNA. The amino termini of the helices of both subunits of IHF are involved as well as a turn between the beta strands. Here are shown contacts on one side of the complex between positively charged amino acids and the phosphates in the dA/dT-sequence .
Although protein HU binds non sequence specific to DNA its structure is remarkably similar to IHF. In its arms there are corresponding intercalating prolines and an arginine binding to the mino groove. However there is one difference: Arg46 is found in all IHF known so far, but absent from HU .
The arm of the IHF alpha-subunit dwells deeper ito the minor groove of the DNA than the arm of the beta-subunit. This is the result of the sum of several interactions determining sequence specificity. Some of these are shown here . Prolineα 65 intercalates in the consensus sequence, Argα 60 and Argα 63 are in contact with bases and Ileα 71, Ileα 73 and Proα 61 interact with ribose in the DNA (have a thorough look by positioning with the mouse!).
this demonstration.
Literature:
T Ellenberger & A Landy, Structure 5 (1997) 153-157;
PA Rice, Curr. Opin. Struct. Biol. 7 (1997) 86-93